View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16248_low_8 (Length: 288)

Name: NF16248_low_8
Description: NF16248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16248_low_8
NF16248_low_8
[»] chr8 (1 HSPs)
chr8 (12-272)||(32319934-32320195)


Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 12 - 272
Target Start/End: Complemental strand, 32320195 - 32319934
Alignment:
Q  12 acagatcaagtcgtaataacaaaatggctaattaacttacgcaaatgcatgaaattcaattgttgcattgtgaatgtgacaaatact-aggtaacttgca 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  32320195 acagatcaagtcgtaataacaaaatggctaattaacttacgcaaatgcatgaaattcaattgttgcattgtgaatgtgacaaatactaaggtaacttgca 32320096  T
Q  111 attaagcaaaacggccaaacgacagcttgtcnnnnnnnnacgtgagcagattaaaatattatatgctttaagaaaacaaataaaaaggcaattgtgcagt 210  Q
    ||||||||||||||| |||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32320095 attaagcaaaacggcaaaacgacagcttgtcttttttttacgtgagcagattaaaatattatatgctttaagaaaacaaataaaaaggcaattgtgcagt 32319996  T
Q  211 ttccttttaataaggaccgcatttaaggatcattgaatttaacttagttgataggaacaata 272  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||    
T  32319995 ttccttttaataaggaccgcatttaagggtcattgaatttaacttagttgatagggacaata 32319934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University