View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16248_high_19 (Length: 207)

Name: NF16248_high_19
Description: NF16248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16248_high_19
NF16248_high_19
[»] chr8 (1 HSPs)
chr8 (1-133)||(4620754-4620886)


Alignment Details
Target: chr8 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 4620754 - 4620886
Alignment:
Q  1 acaaagaaacaaaacaatatctaacgatcatatacatacaatcgcttacgagtcgggacgatacgaaattgaagaaaaagaaagcttgccctggaaggaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4620754 acaaagaaacaaaacaatatctaacgatcatatacatacaatcgcttacgagtcgggacgatacgaaattgaagaaaaagaaagcttgccctggaaggaa 4620853  T
Q  101 gagaaatattgtagagaggagcagattggttcc 133  Q
    |||||| ||||||||||||||||||||||||||    
T  4620854 gagaaagattgtagagaggagcagattggttcc 4620886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University