View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16244_low_33 (Length: 245)

Name: NF16244_low_33
Description: NF16244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16244_low_33
NF16244_low_33
[»] chr4 (2 HSPs)
chr4 (152-228)||(48207845-48207921)
chr4 (5-41)||(48206069-48206105)


Alignment Details
Target: chr4 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 152 - 228
Target Start/End: Original strand, 48207845 - 48207921
Alignment:
Q  152 aagagcttgtagagttattctacattccatcatttgctatttttaacaactcaaccttattttgagttattcaatat 228  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48207845 aagagcttgtagagttattctacattccatcatttgctatttttaacaactcaaccttattttgagttattcaatat 48207921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 41
Target Start/End: Original strand, 48206069 - 48206105
Alignment:
Q  5 gtctttaacgtcattttctttattttctaaatatcat 41  Q
    |||||||||||||||||||||||||| ||| ||||||    
T  48206069 gtctttaacgtcattttctttattttttaattatcat 48206105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University