View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16241_low_11 (Length: 256)

Name: NF16241_low_11
Description: NF16241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16241_low_11
NF16241_low_11
[»] chr2 (2 HSPs)
chr2 (16-140)||(44047974-44048098)
chr2 (136-241)||(44047993-44048098)
[»] chr4 (2 HSPs)
chr4 (17-134)||(3142559-3142676)
chr4 (137-240)||(3142559-3142662)


Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 16 - 140
Target Start/End: Complemental strand, 44048098 - 44047974
Alignment:
Q  16 gaatatctgggtacaaatccagcctttttcccaatcccaaagctttatgagcatatcatcagatgacgacagaacataaggaagggtgggatgaactgcc 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44048098 gaatatctgggtacaaatccagcctttttcccaatcccaaagctttatgagcatatcatcagatgacgacagaacataaggaagggtgggatgaactgcc 44047999  T
Q  116 acacatctaatgtaatctgtatgtg 140  Q
    |||||||||||||||||||||||||    
T  44047998 acacatctaatgtaatctgtatgtg 44047974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 136 - 241
Target Start/End: Original strand, 44047993 - 44048098
Alignment:
Q  136 atgtgtggcagttcatcccacccttccttatgttctgtcgtcatctgatgatatgctcataaagctttgggattgggaaaaaggctggatttgtacccag 235  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44047993 atgtgtggcagttcatcccacccttccttatgttctgtcgtcatctgatgatatgctcataaagctttgggattgggaaaaaggctggatttgtacccag 44048092  T
Q  236 atattc 241  Q
    ||||||    
T  44048093 atattc 44048098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 17 - 134
Target Start/End: Original strand, 3142559 - 3142676
Alignment:
Q  17 aatatctgggtacaaatccagcctttttcccaatcccaaagctttatgagcatatcatcagatgacgacagaacataaggaagggtgggatgaactgcca 116  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||| || ||||| ||||||||||||||||| ||||    
T  3142559 aatatctgggtacagatccagcctttttcccaatcccaaagctttatgagcatatcatccgacgacgatagcacatagggaagggtgggatgaacagcca 3142658  T
Q  117 cacatctaatgtaatctg 134  Q
    |||| |||||||||||||    
T  3142659 cacacctaatgtaatctg 3142676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 137 - 240
Target Start/End: Complemental strand, 3142662 - 3142559
Alignment:
Q  137 tgtgtggcagttcatcccacccttccttatgttctgtcgtcatctgatgatatgctcataaagctttgggattgggaaaaaggctggatttgtacccaga 236  Q
    |||||||| ||||||||||||||||| ||||| || ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  3142662 tgtgtggctgttcatcccacccttccctatgtgctatcgtcgtcggatgatatgctcataaagctttgggattgggaaaaaggctggatctgtacccaga 3142563  T
Q  237 tatt 240  Q
    ||||    
T  3142562 tatt 3142559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University