View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16240_low_76 (Length: 228)

Name: NF16240_low_76
Description: NF16240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16240_low_76
NF16240_low_76
[»] chr3 (1 HSPs)
chr3 (16-173)||(23034369-23034525)


Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 16 - 173
Target Start/End: Original strand, 23034369 - 23034525
Alignment:
Q  16 atgaaggaacatgaaagtgagagtgcagccgaaggttcagaatctagtttggagagactgttgtggtggttgttggttatgtgcaaacggttgtatggaa 115  Q
    |||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||    
T  23034369 atgaagcaacatgaaagtgagagtgcaaccgaaggttcagaatctagtttggagagactgttgtggtggttgttggttatgtgccaacggttgt-tggaa 23034467  T
Q  116 aacatgtggctttatccagatcccgaaagattgaaatgtcacgtggatgctagatttc 173  Q
    ||||||||||||||||||||||||||||||||||||||| || |||||||||||||||    
T  23034468 aacatgtggctttatccagatcccgaaagattgaaatgtaacatggatgctagatttc 23034525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University