View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16240_high_83 (Length: 219)

Name: NF16240_high_83
Description: NF16240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16240_high_83
NF16240_high_83
[»] chr3 (1 HSPs)
chr3 (13-126)||(39053585-39053698)


Alignment Details
Target: chr3 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 13 - 126
Target Start/End: Complemental strand, 39053698 - 39053585
Alignment:
Q  13 ataattctgttgtaaccattcannnnnnncttctacacatacgtacatccattatcccaaaagatttacgtatgactaaacggttcatattcttcatctt 112  Q
    ||||||||||||||||||||||       |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  39053698 ataattctgttgtaaccattcatttttttcttcaacacatacgtacatccattatcccaaaagatttacgtatgactaaacggttcatattcttgatctt 39053599  T
Q  113 caaattttaaacaa 126  Q
    ||||||||||||||    
T  39053598 caaattttaaacaa 39053585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University