View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1623_2D_high_58 (Length: 257)

Name: NF1623_2D_high_58
Description: NF1623_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1623_2D_high_58
NF1623_2D_high_58
[»] chr5 (3 HSPs)
chr5 (105-240)||(10493243-10493378)
chr5 (1-112)||(10494126-10494237)
chr5 (26-85)||(2378578-2378637)
[»] chr4 (1 HSPs)
chr4 (9-174)||(27639581-27639744)
[»] chr8 (2 HSPs)
chr8 (27-102)||(28622576-28622651)
chr8 (51-98)||(32662559-32662606)


Alignment Details
Target: chr5 (Bit Score: 104; Significance: 6e-52; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 105 - 240
Target Start/End: Complemental strand, 10493378 - 10493243
Alignment:
Q  105 gtgggaacaaacattactctttggtttgaatgagtctccggttgctccgagcaccccccttgcagggaggaagctaaatgtgttacgagtaatttaccaa 204  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||||||||||| |||||||| | |||||||||||    
T  10493378 gtgggaacaaacattactctttggtttgaatgagtcttcggttgctccgagcacccccctcgcaaggaggaagctaagtgtgttactaataatttaccaa 10493279  T
Q  205 atactatatttgagtcattttgtatcaggtctatat 240  Q
    ||||||||||| ||||||||||||| ||||||||||    
T  10493278 atactatatttaagtcattttgtatgaggtctatat 10493243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 10494237 - 10494126
Alignment:
Q  1 ttatatagagagtgggtgttgcagaagccgttgttaggcagacgttgagctcgacggttacggattcgtaggaattgtaaccgtcaagcgagattcacgg 100  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||    
T  10494237 ttatatagagagtgggtgttgcagaagccgttgttaggcacacgttgagctcgacggttacggattcgtgggaatcgtaaccgtcaagcgagattcacgg 10494138  T
Q  101 gaacgtgggaac 112  Q
    ||||||||||||    
T  10494137 gaacgtgggaac 10494126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 26 - 85
Target Start/End: Complemental strand, 2378637 - 2378578
Alignment:
Q  26 agccgttgttaggcagacgttgagctcgacggttacggattcgtaggaattgtaaccgtc 85  Q
    ||||||||| ||||| ||||   ||||||||||||||||||||| |||||||||||||||    
T  2378637 agccgttgtaaggcatacgtgaggctcgacggttacggattcgtgggaattgtaaccgtc 2378578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 9 - 174
Target Start/End: Original strand, 27639581 - 27639744
Alignment:
Q  9 agagtgggtgttgcagaagccgttgttaggcagacgttgagctcgacggttacggattcgtaggaattgtaaccgtcaagcgagattcacgggaacgtgg 108  Q
    |||||||||||||||| ||  |||||| |||| | |||| ||||||||||||| ||||||| ||||||||||||||| |||||||||  ||||| |||||    
T  27639581 agagtgggtgttgcaggagttgttgtttggcacatgttgggctcgacggttacagattcgtgggaattgtaaccgtcgagcgagatt-gcgggagcgtgg 27639679  T
Q  109 gaacaaacattactctttggtttgaatgagtctccggttgctccgagcaccccccttgcagggagg 174  Q
    |   | || | |||||||||||||||||||||| ||||||||||||||| ||||||||||||||||    
T  27639680 ggtgagacgtaactctttggtttgaatgagtcttcggttgctccgagca-cccccttgcagggagg 27639744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 27 - 102
Target Start/End: Complemental strand, 28622651 - 28622576
Alignment:
Q  27 gccgttgttaggcagacgttgagctcgacggttacggattcgtaggaattgtaaccgtcaagcgagattcacggga 102  Q
    |||||||||||||| ||||   |||||||||||||  |||||||||||  ||||||||| |||||||||| |||||    
T  28622651 gccgttgttaggcatacgtaaggctcgacggttacccattcgtaggaagcgtaaccgtcgagcgagattcgcggga 28622576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 51 - 98
Target Start/End: Complemental strand, 32662606 - 32662559
Alignment:
Q  51 tcgacggttacggattcgtaggaattgtaaccgtcaagcgagattcac 98  Q
    ||||||||| | ||||||| ||||| ||||||||||||||||||||||    
T  32662606 tcgacggttgcagattcgtgggaatcgtaaccgtcaagcgagattcac 32662559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University