View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16237_low_15 (Length: 222)

Name: NF16237_low_15
Description: NF16237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16237_low_15
NF16237_low_15
[»] chr2 (1 HSPs)
chr2 (19-120)||(40319271-40319372)


Alignment Details
Target: chr2 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 19 - 120
Target Start/End: Complemental strand, 40319372 - 40319271
Alignment:
Q  19 aaaataggattagacttggagcttaaaacataagctcacttacacgtaaagtgggtgtgagtgaaaaatatgaaataagtacattacggatttaaagctt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40319372 aaaataggattagacttggagcttaaaacataagctcacttacacgtaaagtgggtgtgagtgaaaaatatgaaataagtacattacggatttaaagctt 40319273  T
Q  119 ag 120  Q
    ||    
T  40319272 ag 40319271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University