View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16235_low_44 (Length: 253)

Name: NF16235_low_44
Description: NF16235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16235_low_44
NF16235_low_44
[»] chr7 (1 HSPs)
chr7 (1-244)||(46557394-46557640)


Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 46557394 - 46557640
Alignment:
Q  1 tgtaattgttgttcttctggtggtagaggtggtggtgcttcttgaacaactactagttcgggtcttgtttctgttgcttccattgggaagtgaaaagaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46557394 tgtaattgttgttcttctggtggtagaggtggtggtgcttcttgaacaactactagttcgggtcttgtttctgttgcttccattgggaagtgaaaagaaa 46557493  T
Q  101 caagagcgatgtttagaaagagaaagagaggaggttactaattaagaaca---aggctttaaggttaattttggtatataaaaggtgatcacgaagaaga 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||||    
T  46557494 caagagcgatgtttagaaagagaaagagaggaggttactaattaagaacaaggaggctttaaggttaattttggtatataaaaggtgatcacgaagaaga 46557593  T
Q  198 atgggaggagaatatcgttagaaattcctagatctttccagaataat 244  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  46557594 atgggaggagaatatcgttagaaattcctagatctttccagaataat 46557640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University