View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16235_low_34 (Length: 294)

Name: NF16235_low_34
Description: NF16235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16235_low_34
NF16235_low_34
[»] chr6 (2 HSPs)
chr6 (33-91)||(31037093-31037151)
chr6 (168-238)||(31074219-31074289)


Alignment Details
Target: chr6 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 33 - 91
Target Start/End: Complemental strand, 31037151 - 31037093
Alignment:
Q  33 gtatagttatctttaagaaggaagaaaatagagctgagtgagaatgttcaaaaaggaat 91  Q
    |||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  31037151 gtattgttatctttaagaaggaagaaaatagagctgagagagaatgttcaaaaaggaat 31037093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 168 - 238
Target Start/End: Complemental strand, 31074289 - 31074219
Alignment:
Q  168 tgatgtatgctcaaaagaaacttgattcaatttcaatactagtgctcgaaatacttcggttgtctaatgtt 238  Q
    |||||| |||||||||||||||| ||| ||||||||||| | ||||| ||||| |||| || |||||||||    
T  31074289 tgatgtgtgctcaaaagaaacttaatttaatttcaataccaatgctcaaaataattcgattctctaatgtt 31074219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University