View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16223_low_16 (Length: 249)

Name: NF16223_low_16
Description: NF16223
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16223_low_16
NF16223_low_16
[»] chr4 (1 HSPs)
chr4 (13-233)||(4961515-4961737)


Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 13 - 233
Target Start/End: Complemental strand, 4961737 - 4961515
Alignment:
Q  13 aatatgtcggctcagttgatagagtttcacttcctaatttgagggaataaagttcaaatatcacctaaacagacccccttaatgcaactgttactagcaa 112  Q
    |||||||| ||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4961737 aatatgtcagctcagttgatagagtttcacttcctaatttcaggaaataaagttcaaatatcacctaaacagacccccttaatgcaactgttactagcaa 4961638  T
Q  113 aatttccccttcctcaattgaaaaatactatgtatatataagggaacaaccttatatcttgtttaatttatgatgagatttattaatttaatggt---ac 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   ||    
T  4961637 aatttccccttcctcaattgaaaaatactatgtatatataagggaacaaccttatatcttgtttaatttatgatgagatttattaatttaatggtacgac 4961538  T
Q  210 aaactagcttgcaaatgatgtaag 233  Q
    |||||||| | |||||||||||||    
T  4961537 aaactagc-tacaaatgatgtaag 4961515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University