View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1621_low_32 (Length: 238)

Name: NF1621_low_32
Description: NF1621
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1621_low_32
NF1621_low_32
[»] chr2 (1 HSPs)
chr2 (74-238)||(6667673-6667831)


Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 74 - 238
Target Start/End: Original strand, 6667673 - 6667831
Alignment:
Q  74 ttatgctaacaacttgctttgccttttcccttcaccaatttggctcacttttatccttcccataatttcttattccctatctttcactttcattcagatg 173  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||    
T  6667673 ttatgctaacaacttgctttgccttttcccttcaccaatttggctcacttttacccttcccgtaatttcttattccctatctttcactttcattcagatg 6667772  T
Q  174 gggtttgggttttcacagccacgccaccgcttgcaaccactaccacatctccttgcaaccaccgc 238  Q
          |||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||    
T  6667773 ------gggttttcacagccacaccaccgcttgcaaccactgccacatctccttgcaaccaccgc 6667831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University