View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16218_low_23 (Length: 250)

Name: NF16218_low_23
Description: NF16218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16218_low_23
NF16218_low_23
[»] chr4 (1 HSPs)
chr4 (1-179)||(1759254-1759432)


Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 179
Target Start/End: Complemental strand, 1759432 - 1759254
Alignment:
Q  1 tcctgagtttccaggtatcccacaagaccctgttcctaatcctgatcctgtgccgtgggaagaccagccgtcgccatcagaagtgtttccgccatcggtt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1759432 tcctgagtttccaggtatcccacaagaccctgttcctaatcctgatcctgtgccgtgggaagaccagccgtcgccatcagaagtgtttccgccatcggtt 1759333  T
Q  101 gattcacctccatgaatgcatttgttatccttacttggagctatattcagttctcttattgggacttagcttgcactac 179  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1759332 gattcacctccatgaatgcatttgttatccttacttggagctatattcagttctcttattgggacttagcttgcactac 1759254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University