View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1620_high_3 (Length: 233)

Name: NF1620_high_3
Description: NF1620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1620_high_3
NF1620_high_3
[»] chr5 (1 HSPs)
chr5 (5-124)||(32822136-32822255)


Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 5 - 124
Target Start/End: Complemental strand, 32822255 - 32822136
Alignment:
Q  5 aataagatttagaaaaagtaatattacatacttggtattgatcttaatggaacacatgtgcatcgtccctattttgtgttttgtgttattattgcacaaa 104  Q
    ||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| | ||||||||||||||||||||||||||||||| |||    
T  32822255 aataagatttaaaaaaagtaatattacatacttggtattgatcttcatggaacacatgtgcaccatccctattttgtgttttgtgttattattgcataaa 32822156  T
Q  105 gagaatcctcgccttcacta 124  Q
     |||||||||||||||||||    
T  32822155 cagaatcctcgccttcacta 32822136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University