View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16202_low_5 (Length: 241)

Name: NF16202_low_5
Description: NF16202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16202_low_5
NF16202_low_5
[»] chr8 (3 HSPs)
chr8 (137-241)||(11151303-11151407)
chr8 (18-75)||(11151248-11151305)
chr8 (30-109)||(11172945-11173028)


Alignment Details
Target: chr8 (Bit Score: 101; Significance: 3e-50; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 137 - 241
Target Start/End: Original strand, 11151303 - 11151407
Alignment:
Q  137 atgtcttcattactgcacataaaattaatgtcaaatgaaaaaacatagaagaaaccctgtttcattacctggataacaattaaccaaactgtagaatata 236  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11151303 atgtcttcattactgaacataaaattaatgtcaaatgaaaaaacatagaagaaaccctgtttcattacctggataacaattaaccaaactgtagaatata 11151402  T
Q  237 tgctt 241  Q
    |||||    
T  11151403 tgctt 11151407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 18 - 75
Target Start/End: Original strand, 11151248 - 11151305
Alignment:
Q  18 cataggaagtgagaaattaaaattaaactactaatattgatttgtggaattcttcatg 75  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11151248 cataggaagtgagaaattaaaattaaactactaatattgatttgtggaattcttcatg 11151305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 30 - 109
Target Start/End: Complemental strand, 11173028 - 11172945
Alignment:
Q  30 gaaattaaaattaaacta--ctaata--ttgatttgtggaattcttcatgattgttatatgttacaactaacttcttcatatcc 109  Q
    |||||| |||||||||||  ||||||  ||| ||||||  ||| ||||||||||||||||||| | ||||||||||||| ||||    
T  11173028 gaaattgaaattaaactatactaataaattggtttgtgagattgttcatgattgttatatgtttccactaacttcttcagatcc 11172945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University