View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16193_low_2 (Length: 210)

Name: NF16193_low_2
Description: NF16193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16193_low_2
NF16193_low_2
[»] chr3 (1 HSPs)
chr3 (18-184)||(2510751-2510917)


Alignment Details
Target: chr3 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 18 - 184
Target Start/End: Original strand, 2510751 - 2510917
Alignment:
Q  18 atatacaacctcaaatagtgtcatccttttggaaatatgaaatgcgatatgagaaatgttaagtatagcgaaccaaaatttaacgaacaactcacaaatt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2510751 atatacaacctcaaatagtgtcatccttttggaaatatgaaatgcgatatgagaaatgttaagtatagcgaaccaaaatttaacgaacaactcacaaatt 2510850  T
Q  118 gattcannnnnnncttaaactttttggtagaaaacatgactcctttcattcacctcttcaaacacca 184  Q
    ||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2510851 gattcatttttttcttaaactttttggtagaaaacatgactcctttcattcacctcttcaaacacca 2510917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University