View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16181_high_8 (Length: 342)

Name: NF16181_high_8
Description: NF16181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16181_high_8
NF16181_high_8
[»] chr4 (1 HSPs)
chr4 (82-291)||(42909918-42910127)


Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 82 - 291
Target Start/End: Original strand, 42909918 - 42910127
Alignment:
Q  82 gtagttagaaatttcaaattacatttttgaagatcgaatcttcgagtgattgtccaaccgatcacatcccatatgcagattgtgcagtcttcagaagacg 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42909918 gtagttagaaatttcaaattacatttttgaagatcgaatcttcgagtgattgtccaaccgatcacatcccatatgcagattgtgcagtcttcagaagacg 42910017  T
Q  182 atattaggcatgtccgactagatgccattgcagtaatggctcccctgcaaagttgacagaaaagcaagctcacaattatacacaataattaacttcttta 281  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42910018 atattaggcatgtccgactagatgccattgcagtaatggctcccctgcaaagttgacagaaaagcaagctcacaattatacacaataattaacttcttta 42910117  T
Q  282 cataactatt 291  Q
    ||||||||||    
T  42910118 cataactatt 42910127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University