View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1617_low_14 (Length: 237)

Name: NF1617_low_14
Description: NF1617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1617_low_14
NF1617_low_14
[»] chr1 (1 HSPs)
chr1 (10-221)||(45803662-45803873)


Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 10 - 221
Target Start/End: Complemental strand, 45803873 - 45803662
Alignment:
Q  10 tagattatactgggaaactcatagataatatttgaaccattatgttgtgttatgataatacttgaccattgattgattcttcttcactatataggcaaca 109  Q
    |||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45803873 tagattctattgggaaactcatagataatatttgaaccattatgttgtgttatgataatacttgaccattgattgattcttcttcactatataggcaaca 45803774  T
Q  110 gcatttggcatgaaaagtgtcgtgtacgtgccgcgaatcaaattagatacggttgcagcattatctgcattctgtgagaaggccagcatggtgagcaagg 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45803773 gcatttggcatgaaaagtgtcgtgtacgtgccgcgaatcaaattagatacggttgcagcattatctgcattctgtgagaaggccagcatggtgagcaagg 45803674  T
Q  210 ggtgagacttat 221  Q
    ||||||||||||    
T  45803673 ggtgagacttat 45803662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University