View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16177_low_97 (Length: 264)

Name: NF16177_low_97
Description: NF16177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16177_low_97
NF16177_low_97
[»] chr4 (1 HSPs)
chr4 (67-240)||(54951169-54951344)
[»] chr7 (1 HSPs)
chr7 (191-231)||(46334697-46334737)


Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 67 - 240
Target Start/End: Complemental strand, 54951344 - 54951169
Alignment:
Q  67 atgagatgaataagaaacggacgaagggcatataaaagtgaga-aaaatatcataatacaaaatcccaacagtt-aatcgatgattcttgtggttagata 164  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  54951344 atgagatgaataagaaacggacgaagggcatataaaagtgagataaaatatcataatacaaaatcccaacagttgaatcgatgattcttgtggttagata 54951245  T
Q  165 gattaataatttattgaactaacttatataagcttatttgatcaaatgaaaagtgtttggtaaacaaacttttctt 240  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |||||||||||    
T  54951244 gattaataatttattgaactaacttatataagcttgtttgatcaaatgaaaagtgtttgctaaataaacttttctt 54951169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 191 - 231
Target Start/End: Original strand, 46334697 - 46334737
Alignment:
Q  191 tataagcttatttgatcaaatgaaaagtgtttggtaaacaa 231  Q
    ||||||||| ||||||||||||| | |||||||||||||||    
T  46334697 tataagcttgtttgatcaaatgagacgtgtttggtaaacaa 46334737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University