View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16177_low_94 (Length: 275)

Name: NF16177_low_94
Description: NF16177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16177_low_94
NF16177_low_94
[»] chr4 (2 HSPs)
chr4 (19-196)||(32874508-32874685)
chr4 (226-266)||(32874438-32874478)


Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 19 - 196
Target Start/End: Complemental strand, 32874685 - 32874508
Alignment:
Q  19 taaacataattgaccatgtttgtggctagtgtcagttgaagaaccaaaacaacttctagcagaaagttgagctagcagtgtctgaaatcacaagaaattt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32874685 taaacataattgaccatgtttgtggctagtgtcagttgaagaaccaaaacaacttctagcagaaagttgagctagcagtgtctgaaatcacaagaaattt 32874586  T
Q  119 tgagcgtttctgggagaaccacgtaatatctaccagatagtggtgccaagaaatttgtaaaatggaggcaacctacac 196  Q
    ||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  32874585 tgagcgtttctgggagaacgacgtaatatctaccagatagtggtgtcaagaaatttgtaaaatggaggcaacctacac 32874508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 226 - 266
Target Start/End: Complemental strand, 32874478 - 32874438
Alignment:
Q  226 tattttactttattattgtatatgattgaacctattcatct 266  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  32874478 tattttactttattattgtatatgattgaacctattcatct 32874438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University