View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16177_low_77 (Length: 311)

Name: NF16177_low_77
Description: NF16177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16177_low_77
NF16177_low_77
[»] chr5 (1 HSPs)
chr5 (15-83)||(17783666-17783734)


Alignment Details
Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 15 - 83
Target Start/End: Complemental strand, 17783734 - 17783666
Alignment:
Q  15 tgtggtccttgtagagatctcataatgctcacattattttggagcagaatacataggtgttctagttgg 83  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  17783734 tgtggttcttgtagagatctcataatgctcacattattttggagcagaatacataggtgttctagttgg 17783666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University