View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16177_low_130 (Length: 204)

Name: NF16177_low_130
Description: NF16177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16177_low_130
NF16177_low_130
[»] chr2 (1 HSPs)
chr2 (13-189)||(29503836-29504012)


Alignment Details
Target: chr2 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 13 - 189
Target Start/End: Original strand, 29503836 - 29504012
Alignment:
Q  13 acttttctcttgcatttgttttgttagctttgattactttataatggttctagacacttgagtgtgtctacggcataacatttagaaattggagggtgaa 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29503836 acttttctcttgcatttgttttgttagctttgattactttataatggttctagacacttgagtgtgtctacggcataacatttagaaattggagggtgaa 29503935  T
Q  113 tgttgttaaggaatgttgttttaagttgccaattttattcatattatagtgatgtaatgcattgattcatgcctatg 189  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||    
T  29503936 tgttgttaaggaatgttgttttaagttgccaattttgttcatattatagtgatgtaatgcactgattcatgcctatg 29504012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University