View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16177_low_129 (Length: 206)

Name: NF16177_low_129
Description: NF16177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16177_low_129
NF16177_low_129
[»] chr8 (1 HSPs)
chr8 (66-198)||(41058926-41059058)


Alignment Details
Target: chr8 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 66 - 198
Target Start/End: Complemental strand, 41059058 - 41058926
Alignment:
Q  66 gtcatggtttaaacattgtgcgtgattttaaaccctattgactttaagaatcatttgcatgtttttaatttcagaatttgaataatctgtgcacaaaaat 165  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41059058 gtcatggtttaaacattgtgcgtgattttaaaacctattgactttaagaatcatttgcatgtttttaatttcagaatttgaataatctgtgcacaaaaat 41058959  T
Q  166 tgtagtttttgtgtgtgcatttgctgatgatgt 198  Q
    |||||||||||||||||||||||||||||||||    
T  41058958 tgtagtttttgtgtgtgcatttgctgatgatgt 41058926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University