View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16177_high_51 (Length: 354)

Name: NF16177_high_51
Description: NF16177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16177_high_51
NF16177_high_51
[»] chr1 (1 HSPs)
chr1 (208-338)||(45705572-45705710)


Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 208 - 338
Target Start/End: Complemental strand, 45705710 - 45705572
Alignment:
Q  208 gtatcgttatcttctgagaagcttctggtaaaccagttccaatcgtgtgtacgtcatccactacccctaacttagcctaacgtgttcc--------taca 299  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||        ||||    
T  45705710 gtatcgttatcttctgagaagcttctggtaaaccagttccaatcgtgtgtacgtcatccactaccccttacttagcctaacgttttccctatctgataca 45705611  T
Q  300 acttcgtatgtcaattgcaaacactctgatttgctctat 338  Q
    |||||||||||||||||||||||||||||||||||||||    
T  45705610 acttcgtatgtcaattgcaaacactctgatttgctctat 45705572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University