View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16176_low_23 (Length: 215)

Name: NF16176_low_23
Description: NF16176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16176_low_23
NF16176_low_23
[»] chr2 (2 HSPs)
chr2 (151-211)||(21435876-21435936)
chr2 (45-114)||(27155442-27155511)


Alignment Details
Target: chr2 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 151 - 211
Target Start/End: Complemental strand, 21435936 - 21435876
Alignment:
Q  151 tcatagattataccattggcaaatgaaattatagattgcataatgcaattagcaggttctg 211  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21435936 tcatatattataccattggcaaatgaaattatagattgcataatgcaattagcaggttctg 21435876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 45 - 114
Target Start/End: Complemental strand, 27155511 - 27155442
Alignment:
Q  45 taaatataaaataactttcatctaatttgatcttgcgttttttcttttatcttttatataagcgacatat 114  Q
    ||||||||||||||||||||||||||||||||||  || | |  |||||||||||||||||| |||||||    
T  27155511 taaatataaaataactttcatctaatttgatcttatgtgtctgattttatcttttatataagtgacatat 27155442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University