View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16172_high_28 (Length: 247)

Name: NF16172_high_28
Description: NF16172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16172_high_28
NF16172_high_28
[»] chr3 (1 HSPs)
chr3 (11-221)||(45130430-45130647)


Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 11 - 221
Target Start/End: Complemental strand, 45130647 - 45130430
Alignment:
Q  11 gaagaagtattccaagtatacagtaataattatctttttgctgctgaaaatagctatatagacaagacccagcacaccgtggtaattgctctct------ 104  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||          
T  45130647 gaagaagtattccaagtatacagtaataattatctttttgttgctgaaaatagttatatagacaagacccagcacaccgtggtaattgctctctctctct 45130548  T
Q  105 ----gtcacatctctttcaacaccaataatatttgaggcctgccattaaaaaagttaaaattgtaatcatatttataatagactagaaaacacaaattcc 200  Q
        ||||||||||||||||||||||||   ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  45130547 ctctgtcacatctctttcaacaccaata---tttcaggcctgccattaaaaaagttaaaattgtaatcatatttataatagactagaatacacaaattcc 45130451  T
Q  201 acccaccacattgccccacca 221  Q
    |||||||||||||||||||||    
T  45130450 acccaccacattgccccacca 45130430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University