View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16167_low_8 (Length: 236)

Name: NF16167_low_8
Description: NF16167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16167_low_8
NF16167_low_8
[»] chr6 (2 HSPs)
chr6 (91-204)||(34256628-34256740)
chr6 (28-61)||(34256736-34256769)


Alignment Details
Target: chr6 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 91 - 204
Target Start/End: Complemental strand, 34256740 - 34256628
Alignment:
Q  91 atacggatatatagaaagatagatttatttcaaaaaatgtccaaaggagtgaagatagtagcaaaaattgtacttagtt-ccaaataatgactcaaaact 189  Q
    ||||||||||| ||||||| | ||||||| ||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||  ||||    
T  34256740 atacggatatagagaaagacaaatttattgcaaaaaaagtccaaaggagtgaagatagtagcaaaaaatgtacttagttcccaaataatgactc--aact 34256643  T
Q  190 gggaaaaattgaaca 204  Q
    |||||||||||||||    
T  34256642 gggaaaaattgaaca 34256628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 61
Target Start/End: Complemental strand, 34256769 - 34256736
Alignment:
Q  28 tcttcaagactaaaccaagtcaatctagaatacg 61  Q
    |||||||||||||||||||||||||| |||||||    
T  34256769 tcttcaagactaaaccaagtcaatctggaatacg 34256736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University