View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16165_low_20 (Length: 279)

Name: NF16165_low_20
Description: NF16165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16165_low_20
NF16165_low_20
[»] chr8 (1 HSPs)
chr8 (19-107)||(9720392-9720480)


Alignment Details
Target: chr8 (Bit Score: 77; Significance: 9e-36; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 19 - 107
Target Start/End: Original strand, 9720392 - 9720480
Alignment:
Q  19 aatcaaaagtagtgccaacattaggggaccatatctttacacaatataaaactgtccattttcttatttctatttaccctacattttag 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |||||||||    
T  9720392 aatcaaaagtagtgccaacattaggggaccatatctttacacaatataaatctgtccattttcttatttttatttaccccacattttag 9720480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University