View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16165_high_25 (Length: 219)

Name: NF16165_high_25
Description: NF16165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16165_high_25
NF16165_high_25
[»] chr7 (1 HSPs)
chr7 (14-104)||(47991398-47991490)


Alignment Details
Target: chr7 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 14 - 104
Target Start/End: Complemental strand, 47991490 - 47991398
Alignment:
Q  14 attccattcctagaaaaagaatcagagtgtgtcgactaccaaatacttgcatcgattcagctt--aacctatttattatccctctctccattt 104  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||| | |||||||||  |||||||||||||||||||||| |||||    
T  47991490 attccattcctagaaaaagaatcagagtgtgtcgacttccaaatacttgcaacaattcagctttgaacctatttattatccctctcttcattt 47991398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University