View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16160_low_15 (Length: 251)

Name: NF16160_low_15
Description: NF16160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16160_low_15
NF16160_low_15
[»] chr6 (1 HSPs)
chr6 (6-167)||(6207836-6207999)


Alignment Details
Target: chr6 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 6 - 167
Target Start/End: Original strand, 6207836 - 6207999
Alignment:
Q  6 aattggctagtgtttgatggagaataggttagtgttcaaagtgaaagattcatagattattacatgaataagaccatgtt------tttgagacactatg 99  Q
    ||||| |||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||   |||||||||      ||||||| ||||||    
T  6207836 aattgactagtgtttgatggagaataggctagtgttcaaagtgaaagattcataggttattacatgaa---gaccatgtttttgtttttgagagactatg 6207932  T
Q  100 tttcttccataaatgtggtcttctctatgtaattgtcttgttttttcactttgcaaccctagcacatc 167  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||    
T  6207933 tttcttccataaatgtggtcttctctatgtaattgtcttg-tttttcactttgcatccctagcacatc 6207999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University