View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16160_high_15 (Length: 245)

Name: NF16160_high_15
Description: NF16160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16160_high_15
NF16160_high_15
[»] chr5 (2 HSPs)
chr5 (113-238)||(5041870-5041996)
chr5 (18-52)||(5042057-5042091)


Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 113 - 238
Target Start/End: Complemental strand, 5041996 - 5041870
Alignment:
Q  113 atgttccatcacttcca-cataaaagcctattatttttaccaatatattgcttcttcctactttctatagtgtcattcagtttgtgctattttgcttcat 211  Q
    ||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5041996 atgttccatcacttccaacataaaagcctattttttttaccaatatattgcttcttcctactttctatagtgtcattcagtttgtgctattttgcttcat 5041897  T
Q  212 cttttacaatcagtcccttcacttctc 238  Q
    |||||||||||||||||||||||||||    
T  5041896 cttttacaatcagtcccttcacttctc 5041870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 18 - 52
Target Start/End: Complemental strand, 5042091 - 5042057
Alignment:
Q  18 gtttggatagaggctcgtcaaccaaaggagaggta 52  Q
    |||||||||||||||||||||||||||||||||||    
T  5042091 gtttggatagaggctcgtcaaccaaaggagaggta 5042057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University