View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16154_high_15 (Length: 280)

Name: NF16154_high_15
Description: NF16154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16154_high_15
NF16154_high_15
[»] chr1 (2 HSPs)
chr1 (18-152)||(6123119-6123253)
chr1 (163-271)||(6122933-6123041)


Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 18 - 152
Target Start/End: Complemental strand, 6123253 - 6123119
Alignment:
Q  18 atatgtcataggagttggttaggtggatggctcaagcctcagaagaagagttactttgctttgcaactccctaaacggtggtgggtttttgggcttgacc 117  Q
    |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6123253 atatgttataggagttggttaggtggatggctcatgcctcagaagaagagttactttgctttgcaactccctaaacggtggtgggtttttgggcttgacc 6123154  T
Q  118 ttgctcttcataatgatatagatgtgtaccaattc 152  Q
    ||||||||||||||||||| |||||||||||||||    
T  6123153 ttgctcttcataatgatatcgatgtgtaccaattc 6123119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 163 - 271
Target Start/End: Complemental strand, 6123041 - 6122933
Alignment:
Q  163 tttaagtttgcttcataaagtctctactgtttaatgtgattttacttacataatttgtagagaattctttaagttttcattattagtcattcgtttgttg 262  Q
    |||||| ||||||||||||||||||| ||| |||||||||||||||||||||||||||  |||||||||||  ||||||||||||||||||| |||| ||    
T  6123041 tttaagcttgcttcataaagtctctagtgtctaatgtgattttacttacataatttgtgcagaattctttaccttttcattattagtcattcatttgctg 6122942  T
Q  263 ttgcctttg 271  Q
    |||||||||    
T  6122941 ttgcctttg 6122933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University