View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16152_high_5 (Length: 230)

Name: NF16152_high_5
Description: NF16152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16152_high_5
NF16152_high_5
[»] chr2 (2 HSPs)
chr2 (74-210)||(32417053-32417191)
chr2 (19-49)||(32417179-32417209)


Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 74 - 210
Target Start/End: Complemental strand, 32417191 - 32417053
Alignment:
Q  74 tctttctctttgatattgattc--gtttaatgtttgagttgccctaaaatcatgtccttgatataaagggttttctattcacaaagctaggaacaaactt 171  Q
    ||||||||||||||||||||||  ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  32417191 tctttctctttgatattgattcttgtttaatgtttgagttggcctaaaatcatgtccttgatataaagcgttttctattcacaaagctaggaacaaactt 32417092  T
Q  172 gaaggactttgtgctttcaccatgtcaccacctatgact 210  Q
    |||||||||||||||||||||||||||||||||||||||    
T  32417091 gaaggactttgtgctttcaccatgtcaccacctatgact 32417053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 49
Target Start/End: Complemental strand, 32417209 - 32417179
Alignment:
Q  19 atgaccagcaacttcacctctttctctttga 49  Q
    |||||||||||||||||||||||||||||||    
T  32417209 atgaccagcaacttcacctctttctctttga 32417179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University