View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1614_low_121 (Length: 236)

Name: NF1614_low_121
Description: NF1614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1614_low_121
NF1614_low_121
[»] chr2 (1 HSPs)
chr2 (8-219)||(1557094-1557305)
[»] chr5 (1 HSPs)
chr5 (47-192)||(22005523-22005672)
[»] scaffold0755 (1 HSPs)
scaffold0755 (119-183)||(3721-3785)


Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 8 - 219
Target Start/End: Original strand, 1557094 - 1557305
Alignment:
Q  8 gaaagatttccagatggttcttactcgaaaaggatttacgtgctctaattgttgtgatacggtgtaagtctttatactttatctctcaggaccggtttta 107  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1557094 gaaagatttccagatggttcttactcgaaaaggatttacgtgctataattgttgtgatacggtgtaagtctttatactttatctctcaggaccggtttta 1557193  T
Q  108 actcgttggactttgttttcagtctgttgtcatattttaatgcttccaaatcacaacatcataaggtgctgcaaggatcccatgataaattgaaaacaaa 207  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  1557194 actcgttggactttgttttcagtctgttgtcatattttaatgctgccaaatcacaacatcataaggtgctgcaaggatcccatgataacttgaaaacaaa 1557293  T
Q  208 cagagaccgcac 219  Q
    ||||||||||||    
T  1557294 cagagaccgcac 1557305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 47 - 192
Target Start/End: Complemental strand, 22005672 - 22005523
Alignment:
Q  47 gtgctctaattgttgtgatacggtgtaagtctttatactttatctctcaggaccggttttaactcgttggactt--tgttttcagtctgttgtcatattt 144  Q
    |||||||||||||||||||||  | |||||||||||  |||||||| || |||| |||||||||| ||| | ||  |||||||| | |||  ||||||||    
T  22005672 gtgctctaattgttgtgatacaatttaagtctttattatttatctcacatgaccagttttaactcattgcattttctgttttcaatttgtcatcatattt 22005573  T
Q  145 taatgcttccaaatcaca--acatcataaggtgctgcaaggatcccatga 192  Q
    |  |||| ||||||||||  | |||| |||||||||| ||| ||| ||||    
T  22005572 tgttgctgccaaatcacatgagatcagaaggtgctgctaggttccaatga 22005523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0755 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0755
Description:

Target: scaffold0755; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 119 - 183
Target Start/End: Original strand, 3721 - 3785
Alignment:
Q  119 tttgttttcagtctgttgtcatattttaatgcttccaaatcacaacatcataaggtgctgcaagg 183  Q
    |||||||||||||||| ||||||||||  |||| ||||||| ||  ||||||||||| |||||||    
T  3721 tttgttttcagtctgtcgtcatattttgctgctgccaaatctcatgatcataaggtgttgcaagg 3785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University