View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16148_low_5 (Length: 202)

Name: NF16148_low_5
Description: NF16148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16148_low_5
NF16148_low_5
[»] chr6 (1 HSPs)
chr6 (13-126)||(20399556-20399669)


Alignment Details
Target: chr6 (Bit Score: 102; Significance: 7e-51; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 13 - 126
Target Start/End: Original strand, 20399556 - 20399669
Alignment:
Q  13 ataattctcaattgataatatagtatgctttaattcaatatcaatagacctaaatcttcaaccattccgcatgaaacaaaacgtacacggcaggacttca 112  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||    
T  20399556 ataattctcaattgataatatagtatgctttaattcactatcaatagacctaaatcttcaaccatttcgcatgaaacaaaacgtacacggcaggacatca 20399655  T
Q  113 tgaacaataacatt 126  Q
    ||||||||||||||    
T  20399656 tgaacaataacatt 20399669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University