View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16146_low_15 (Length: 247)

Name: NF16146_low_15
Description: NF16146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16146_low_15
NF16146_low_15
[»] chr7 (1 HSPs)
chr7 (12-181)||(48286251-48286420)


Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 12 - 181
Target Start/End: Complemental strand, 48286420 - 48286251
Alignment:
Q  12 ataggcgacaataattacgtttcttgggttttggtcggaaagaaggtgggagagaagggtttcgtgttggaagcggtttttgttggatgtttgggtctct 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48286420 ataggcgacaataattacgtttcttgggttttggtcggaaagaaggtgggagagaagggtttcgtgttggaagcggtttttgttggatgtttgggtctct 48286321  T
Q  112 ataacaaggtggttttggtagtattattggtttttgttcgggcgatggttgctgcattgtgattttgtgt 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48286320 ataacaaggtggttttggtagtattattggtttttgttcgggcgatggttgctgcattgtgattttgtgt 48286251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University