View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16141_low_22 (Length: 287)

Name: NF16141_low_22
Description: NF16141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16141_low_22
NF16141_low_22
[»] chr3 (2 HSPs)
chr3 (21-225)||(55169115-55169319)
chr3 (241-277)||(55169319-55169355)
[»] chr4 (1 HSPs)
chr4 (48-277)||(27808078-27808307)


Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 21 - 225
Target Start/End: Original strand, 55169115 - 55169319
Alignment:
Q  21 taaaaatactcaagaacgatagtgtagcttacttgttaccgaggagagtgtggagttttatgatgagttgatcttcttgttgggtgaaatttccacgttt 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  55169115 taaaaatactcaagaacgatagtgtagcttacttgttaccgaggagagtgtggagttttatgatgagttgatcttcttgttgggtgaaatttccacgttt 55169214  T
Q  121 gaggtcggggcggaggtagttgatccaccggagacggcaactcttaccgcaacggagaagaccagcggcttttcggagagagcgccagcatccctcaccg 220  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  55169215 gaggtcggggcgtaggtagttgatccaccggagacggcaactcttaccgcaacggagaagaccagcggcttttgggagagagcgccagcatccctcaccg 55169314  T
Q  221 tgagc 225  Q
    |||||    
T  55169315 tgagc 55169319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 241 - 277
Target Start/End: Original strand, 55169319 - 55169355
Alignment:
Q  241 cagccgctcatcttcttctttgctccatgctcctttg 277  Q
    |||||||||||||||||||||||||||||||||||||    
T  55169319 cagccgctcatcttcttctttgctccatgctcctttg 55169355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 48 - 277
Target Start/End: Complemental strand, 27808307 - 27808078
Alignment:
Q  48 cttacttgttaccgaggagagtgtggagttttatgatgagttgatcttcttgttgggtgaaatttccacgtttgaggtcggggcggaggtagttgatcca 147  Q
    ||||||||||||| || ||| | |||||||| |||||||||| |||||||| ||  || || || |||||||| ||||| || | ||| ||||| |||||    
T  27808307 cttacttgttaccaagaagactatggagtttgatgatgagttcatcttcttcttctgtaaagttaccacgtttaaggtctggcctgagatagttaatcca 27808208  T
Q  148 ccggagacggcaactcttaccgcaacggagaagaccagcggcttttcggagagagcgccagcatccctcaccgtgagctctaatataagctatcagccgc 247  Q
    ||||||||| ||||| ||||| || ||||| |  ||||| |||||  ||||||| | ||| || || ||||| || || |||||||| | ||| || |      
T  27808207 ccggagacgacaacttttaccacatcggagtaagccagctgctttagggagagatctccaacaaccttcaccatgtgccctaatatatgatataagtcta 27808108  T
Q  248 tcatcttcttctttgctccatgctcctttg 277  Q
    ||||||||||||||  |||| |||||||||    
T  27808107 tcatcttcttcttttgtccaagctcctttg 27808078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University