View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16135_low_17 (Length: 249)

Name: NF16135_low_17
Description: NF16135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16135_low_17
NF16135_low_17
[»] chr4 (2 HSPs)
chr4 (1-140)||(4163189-4163328)
chr4 (160-227)||(4163132-4163199)


Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 4163328 - 4163189
Alignment:
Q  1 ttactatagtgattggtaattttggagaacccannnnnnnncttcaatgctgcaaaagtatagagataaaaatgtgatatgtgaataattttttggaatt 100  Q
    ||||||||||||| |||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4163328 ttactatagtgatcggtaattttggagaacccattttttttcttcaatgctgcaaaagtatagagataaaaatgtgatatgtgaataattttttggaatt 4163229  T
Q  101 cagtcttttatatgcaagtaaggggaacatgttgtgcata 140  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  4163228 cagtcttttatatgcaagtaaggggaacatgttgtgcata 4163189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 160 - 227
Target Start/End: Complemental strand, 4163199 - 4163132
Alignment:
Q  160 tgttgtgcataccctatagcttttttattaattataaatcgtaaattacaatttcggtccctaaatta 227  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  4163199 tgttgtgcatatcctatagcttttttattaattataaatcgtaaattacaattttggtccctaaatta 4163132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University