View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16129_low_7 (Length: 241)

Name: NF16129_low_7
Description: NF16129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16129_low_7
NF16129_low_7
[»] chr1 (2 HSPs)
chr1 (105-221)||(3482847-3482964)
chr1 (1-70)||(3482773-3482843)


Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 105 - 221
Target Start/End: Original strand, 3482847 - 3482964
Alignment:
Q  105 gaacctttcccggaaagaaaatcagtccaataaagcccaattggataagtggggctctttagcccccatttttgcgggaaaaaaa-cctatttgatcgaa 203  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  3482847 gaacctttccctgaaagaaaatcagtccaataaagcccaattggataagtggggctctttagcccccatttttgcgggaaaaaaaccctatttgatcgaa 3482946  T
Q  204 atgtatcttatgatgatg 221  Q
    ||||||||||||||||||    
T  3482947 atgtatcttatgatgatg 3482964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 3482773 - 3482843
Alignment:
Q  1 gtaacttttgatcggctttttcataaatgtcaccaattatga-ggggtctattgaacaatcatgttcttct 70  Q
    |||| |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  3482773 gtaatttttaatcggctttttcataaatgtcaccaattatgagggggtctattgaacaatcatgttcttct 3482843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University