View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16123_low_79 (Length: 212)

Name: NF16123_low_79
Description: NF16123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16123_low_79
NF16123_low_79
[»] chr8 (1 HSPs)
chr8 (11-196)||(329840-330025)


Alignment Details
Target: chr8 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 11 - 196
Target Start/End: Complemental strand, 330025 - 329840
Alignment:
Q  11 gtgagatgaatattaaactaatgtgatagctatagactcttctactgtagaggataggaatggtgtttgcatagaaatatgaataataataataattatc 110  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  330025 gtgaaatgaatattaaactaatgtgatagctatagactcttctactgtagaggataggaatggtgtttgcatagaaatatgaataataataataattatc 329926  T
Q  111 aatctcctccatcttctacacagcatgctgaacttgatttgtgtgctccggttgattatccaatggcatgtattgggccattattg 196  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  329925 aatctccttcatcttctacacagcatgctgaacttgatttgtgtgctccggttgattatccaatggcatgtattgggccattattg 329840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University