View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16115_low_9 (Length: 250)

Name: NF16115_low_9
Description: NF16115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16115_low_9
NF16115_low_9
[»] chr3 (1 HSPs)
chr3 (13-231)||(34341943-34342161)


Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 13 - 231
Target Start/End: Original strand, 34341943 - 34342161
Alignment:
Q  13 aagaatatagcgtttgggagcagtattatcagtatcttcatatccaagaagcttctgattcaacggcacgccttcaaggaaccggttaccggagaagtta 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  34341943 aagaatatagcgtttgggagcagtattatcagtatcttcatatccaagaagcttctgattcaatggcacgccttcaaggaaccggttaccggagaagtta 34342042  T
Q  113 aagtgtctaagattgcgaaaagaacgaaccgaaactggaactcttcctgtgaagtgattgtctgcaacagaaagagtttccagattgggaaaatacctaa 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34342043 aagtgtctaagattgcgaaaagaacgaaccgaaactggaactcttcctgtgaagtgattgtctgcaacagaaagagtttccagattgggaaaatacctaa 34342142  T
Q  213 ggaaattcaagtttccaga 231  Q
    |||||||||||||||||||    
T  34342143 ggaaattcaagtttccaga 34342161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University