View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16114_low_4 (Length: 227)

Name: NF16114_low_4
Description: NF16114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16114_low_4
NF16114_low_4
[»] chr4 (1 HSPs)
chr4 (1-221)||(35958010-35958240)


Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 35958010 - 35958240
Alignment:
Q  1 atataggagggtttttgtacacggctgagtctgagtgtg----------ttccatcgttggtcgtggttgattgcggctgaacccttgaaaccatggacg 90  Q
    |||||||||||||||||||||||||||||||||||| ||          ||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  35958010 atataggagggtttttgtacacggctgagtctgagtctgagtgtgttcgttccatcgttggttgtggttgattgcggctgaacccttgaaaccatggacg 35958109  T
Q  91 aagaagcagcaatatcagagcgcaaaactggtcacgttaagaagagagctttaaagaacaaagctttgaccatttctttcgacgagaaagatcccaaaga 190  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||    
T  35958110 aagaagcagcaatatcagagcgcaaaactggtcacgttaagaagagagctttaaagaacaaagctttggccatttctttcgacgagaaagatctcaaaga 35958209  T
Q  191 ttatgtcactggctttcacaaacgcaagaag 221  Q
    |||||||||||||||||||||||||||||||    
T  35958210 ttatgtcactggctttcacaaacgcaagaag 35958240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University