View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16112_low_69 (Length: 224)

Name: NF16112_low_69
Description: NF16112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16112_low_69
NF16112_low_69
[»] chr2 (1 HSPs)
chr2 (20-152)||(3590342-3590474)


Alignment Details
Target: chr2 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 20 - 152
Target Start/End: Original strand, 3590342 - 3590474
Alignment:
Q  20 agtatgtctttgactagtggtacatatggattggaaaattaaatgagtattatgtcggaagtaatacattgactaagggaaaatttattccctaataggg 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  3590342 agtatgtctttgactagtggtacatatggattggaaaattaaatgagtattatgtcggaagtaatacattgactaagggaaaatttattctctaataggg 3590441  T
Q  120 acatatttgattatttttaaaaaatacatatta 152  Q
    |||||||||||||||||||||||||||||||||    
T  3590442 acatatttgattatttttaaaaaatacatatta 3590474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University