View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16112_low_56 (Length: 247)

Name: NF16112_low_56
Description: NF16112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16112_low_56
NF16112_low_56
[»] chr2 (1 HSPs)
chr2 (1-232)||(41102876-41103107)


Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 41103107 - 41102876
Alignment:
Q  1 aatcggcgattcagaaggaatcttcgaagattccggtaccaggcggaggaatccatcctctcacacgctatgtcatgaactacatcgcacttctcgccga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41103107 aatcggcgattcagaaggaatcttcgaagattccggtaccaggcggaggaatccatcctctcacacgctatgtcatgaactacatcgcacttctcgccga 41103008  T
Q  101 ttacagcgaagcaatcggcgatatagtttccgattggccacaaactccggtaccggaatcttactacaaaagtccaattcacgacgaggataatccaccg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41103007 ttacagcgaagcaatcggcgatatagtttccgattggccacaaactccggtaccggaatcttactacaaaagtccaattcacgacgaggataatccaccg 41102908  T
Q  201 tcggagatagcgaaacggttatcgtggttgat 232  Q
    ||||||||||||||||||||||||||||||||    
T  41102907 tcggagatagcgaaacggttatcgtggttgat 41102876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University