View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16110_high_5 (Length: 213)

Name: NF16110_high_5
Description: NF16110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16110_high_5
NF16110_high_5
[»] chr4 (1 HSPs)
chr4 (18-198)||(8764208-8764389)


Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 8764389 - 8764208
Alignment:
Q  18 aagggtttatgaggttttggtttgattatgagtgaggtttatgtccttgattttagtgcctttatatagaggnnnnnnn-gtggtggttaacatgtaaac 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         ||||||||||| ||||||||    
T  8764389 aagggtttatgaggttttggtttgattatgagtgaggtttatgtccttgattttagtgcctttatatagagaaaaaaaaagtggtggttaaaatgtaaac 8764290  T
Q  117 tatttgagactgctcaccatgtcatacttttccaacttagcctatggatttgcttgaaatttccatgcacgtcttgattcat 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8764289 tatttgagactgctcaccatgtcatacttttccaacttagcctatggatttgcttgaaatttccatgcacgtcttgattcat 8764208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University