View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16104_low_16 (Length: 296)

Name: NF16104_low_16
Description: NF16104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16104_low_16
NF16104_low_16
[»] chr5 (1 HSPs)
chr5 (18-282)||(35022382-35022646)


Alignment Details
Target: chr5 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 18 - 282
Target Start/End: Original strand, 35022382 - 35022646
Alignment:
Q  18 agcttgatgcgaattcggcttatgcagagatttatctgaagggattggtgaagcatttgaagtccggtgccggaacgccattgttgaaagatggagtgaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35022382 agcttgatgcgaattcggcttatgcagagatttatctgaagggattggtgaagcatttgaagtccggtgccggaacgccattgttgaaagatggagtgaa 35022481  T
Q  118 aggggtttatctgtatgaattgtttgataaggaaggtgctggaaatggaaggaattgggggattttgtatccgaatggttcgacaaagtatgataagatt 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35022482 aggggtttatctgtatgaattgtttgataaggaaggtgctggaaatggaaggaattgggggattttgtatccgaatggttcgacaaagtatgataagatt 35022581  T
Q  218 gatttctcttctggatggaaaagattggtgaatgtgggtttcattttgttgctgattgttcttca 282  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35022582 gatttctcttctggatggaaaagattggtgaatgtgggtttcattttgttgctgattgttcttca 35022646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University