View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16102_low_16 (Length: 236)

Name: NF16102_low_16
Description: NF16102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16102_low_16
NF16102_low_16
[»] chr1 (2 HSPs)
chr1 (131-236)||(25290568-25290673)
chr1 (18-60)||(25290732-25290774)


Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 131 - 236
Target Start/End: Complemental strand, 25290673 - 25290568
Alignment:
Q  131 gatgatagattaaaacgcattcgattcgaagtgcgcatgataatattgataagactttgaaagctgcggaggtgattttggggcagtttgatcagacgcg 230  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25290673 gatgatagattaaaacgcattcgattcgaagtgcgcatgataatattgataagactttgaaagctgcggaggtgattttggggcagtttgatcagacgcg 25290574  T
Q  231 taaggt 236  Q
    ||||||    
T  25290573 taaggt 25290568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 60
Target Start/End: Complemental strand, 25290774 - 25290732
Alignment:
Q  18 gaaaccgcaatgcgtcctactcaggtaatgtgaattggatcaa 60  Q
    |||||||||||||||||||||||||||||||||||||||||||    
T  25290774 gaaaccgcaatgcgtcctactcaggtaatgtgaattggatcaa 25290732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University