View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16102_high_8 (Length: 202)

Name: NF16102_high_8
Description: NF16102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16102_high_8
NF16102_high_8
[»] chr3 (1 HSPs)
chr3 (37-151)||(54235219-54235333)


Alignment Details
Target: chr3 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 37 - 151
Target Start/End: Complemental strand, 54235333 - 54235219
Alignment:
Q  37 atgaaaagttagtgtattgttattgttatttgatgtgctttgtgcttaacttttttagcttgcgttggagtaccactgctatatatataagtagtaatca 136  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  54235333 atgaaaagttagtgtattgttattgttatttgatgtgctttgtgcttaacttttttagcttgcgttggagtaccactactatatatataagtagtaatca 54235234  T
Q  137 caactgcactgtgta 151  Q
    |||||||||||||||    
T  54235233 caactgcactgtgta 54235219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University