View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16091_low_158 (Length: 219)

Name: NF16091_low_158
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16091_low_158
NF16091_low_158
[»] chr4 (2 HSPs)
chr4 (10-219)||(43869513-43869722)
chr4 (123-219)||(43869137-43869229)
[»] chr1 (1 HSPs)
chr1 (149-189)||(31342581-31342621)


Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 10 - 219
Target Start/End: Complemental strand, 43869722 - 43869513
Alignment:
Q  10 tcttctcctacgatcagttgcataatcatatcctagcttctgattgttactgctattccaaacacatcttctcttttccaaccgaatatcttagttttct 109  Q
    |||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  43869722 tcttctcctacgatcagttgcataatcatatcctagcttccgattcttactgctattccaaacacatcttctcttttccaaccgcatatcttagttttct 43869623  T
Q  110 gattccaagtatcgtgttaatatgatctatgtctttcttgtttttgttacttccctctgatttatcattgattgttgtttctacgatttatgttttcata 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43869622 gattccaagtatcgtgttaatatgatctatgtctttcttgtttttgttacttccctctgatttatcattgattgttgtttctacgatttatgttttcata 43869523  T
Q  210 tttgatttga 219  Q
    ||||||||||    
T  43869522 tttgatttga 43869513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 123 - 219
Target Start/End: Original strand, 43869137 - 43869229
Alignment:
Q  123 gtgttaatatgatctatgtctttcttgtttttgttacttccctctgatttatcattgattgttgtttctacgatttatgttttcatatttgatttga 219  Q
    |||||||| |||||||||||||| | |||||| ||| |||||||  | |||||||| ||| |||||||||    |||||||||||||||||||||||    
T  43869137 gtgttaatctgatctatgtctttttagtttttattatttccctccaacttatcattaatttttgtttcta----ttatgttttcatatttgatttga 43869229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 189
Target Start/End: Original strand, 31342581 - 31342621
Alignment:
Q  149 gtttttgttacttccctctgatttatcattgattgttgttt 189  Q
    |||||||||| ||||||||||||||||||| ||| ||||||    
T  31342581 gtttttgttatttccctctgatttatcattaatttttgttt 31342621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University