View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16091_low_139 (Length: 237)

Name: NF16091_low_139
Description: NF16091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16091_low_139
NF16091_low_139
[»] chr4 (1 HSPs)
chr4 (15-219)||(35867679-35867883)


Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 15 - 219
Target Start/End: Original strand, 35867679 - 35867883
Alignment:
Q  15 atgaaggacagggagggtgttttnnnnnnnggagaggaaagagaaagaggaaggattgtgccagaaatattaatgaagcgagtgtgagagaaagtgattt 114  Q
    |||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35867679 atgaaggacagggagggtgttttaaaaaaaggagaggaaagagaaagaggaaggattgtgccagaaatattaatgaagcgagtgtgagagaaagtgattt 35867778  T
Q  115 ttcaattgtcgtgtcccggttgaaagaaagttctaccagcaattgtggtgaggttgtcaaatcttctggtgtaactgaggagaacacaaacttgaaaaag 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  35867779 ttcaattgtcgtgtcccggttgaaagaaagttctaccagcaattgtggtgaggttgtcaaatcttctggtgtaactgaggagaacacgaacttgaaaaag 35867878  T
Q  215 gatgg 219  Q
    |||||    
T  35867879 gatgg 35867883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University